DNA Sequence
ATCTGGTCTGACTTCTGGGAAGCT
DNA Output
Ile Trp Ser Asp Phe Trp Glu Ala
Where it is produced?
Phenylalanine hydroxylase is produced mainly in liver cells. It is encoded by the PAH gene, located on the 12th chromosome. During protein synthesis in liver cells, this gene is expressed as a phenylalanine hydroxylase enzyme, catalyzing the conversion of the amino acid phenylalanine into tyrosine, which is a crucial process in amino acid metabolism.
What's its main role?
As phenylalanine hydroxylase is an enzyme, its main role is to catalyse a specific reaction. In this case, it catalyses the conversion of one amino acid to another - phenylalanine to tyrosine. Phenylalanine is one of the essential amino acids, meaning it can’t be synthesised or converted within the organism, instead it must be obtained from food. Tyrosine is another amino acid significant in protein synthesis, hormone and neurotransmitter production, which has an alike structure to phenylalanine. The main difference is that tyrosine has an additional hydroxyl (OH) group. The liver has an enzyme phenylalanine hydroxylase, which adds OH to the phenylalanine and converts it to tyrosine.
General mechanism of action:
Phenylalanine hydroxylase converts phenylalanine into tyrosine by adding a hydroxyl group (OH) to the phenyl ring in phenylalanine. The enzyme uses oxygen and a helper molecule called tetrahydrobiopterin (BH4) to carry out this reaction. This process helps control phenylalanine levels in the body and produces tyrosine for the production of important molecules like neurotransmitters and hormones.
That ion flow influences water and sodium movement through the concentration gradient.
Functions:
Phenylalanine hydroxylase has one main catalytic function. However, here is why this function is important:
- Breaks down excess phenylalanine from the diet
- Produces tyrosine
Main functions of tyrosine:
- Neurotrnsmitters production (dopamine, norepinephrine, epinephrine)
- Thyroid hormones production
- Melanin pigment production
Structure:
A tetramer, made of four phenylalanine hydroxylase molecules, is a functional unit of this enzyme. Each molecule in a tetramer has three domains: a regulatory domain, a catalytic domain, and a tetramerisation domain. Enzyme activity resides in a catalytic domain, while the tetramerisation domain is responsible for assembling four chains into a tetramer. There is an iron ion in the middle of each catalytic domain, playing an important role in the enzyme’s action process.
Related diseases:
- Phenylketonuria (PKU)
- Hyperphenylalaninemia
A mutation in the PAH gene results in a defective, nonfunctional phenylalanine hydroxylase enzyme. Due to that change the body cannot properly convert phenylalanine into tyrosine. Phenylalanine accumulates in the blood and brain to toxic levels, leading to intellectual disability, development delay, sizures, behavioral problems and musty body or odor if untreated.
Some mutations in the PAH gene only partially reduce the activity of the phenylalanine hydroxylase enzyme. Because of that phenylalanine is broken down more slowly than normal. This causes moderately increased phenylalanine levels in blood. In mild cases symptoms may be minimal, but in more severe cases it can lead to learning difficulties, and developmental problems if not managed with dietary control.